Detection of an immunoglobulin switch region-specific DNA-binding protein in mitogen-stimulated mouse splenic B cells

Mol Cell Biol. 1990 Apr;10(4):1714-8. doi: 10.1128/mcb.10.4.1714-1718.1990.

Abstract

We have detected a nuclear protein from lipopolysaccharide- and dextran sulfate-stimulated mouse splenic B cells which binds specifically to the immunoglobulin switch mu (S mu) sequence. We have termed the binding protein NF-S mu. DNA containing the S mu repeated sequence, GAGCTGGGGTGAGCTGAGCTGAGCT, was used as a probe in electrophoretic mobility shift assays. Methylation interference analysis indicated that binding centers on the run of four guanine residues. Competitions with mutated S mu sequences confirmed the importance of the run of G residues and revealed that optimal binding occurs when they are flanked by GAGCT. The kinetics of the expression of NF-S mu in splenic B cells treated with lipopolysaccharide and dextran sulfate parallels the induction of recombinational activity at S mu in these cells. On the basis of these data, we suggest that NF-S mu may be an effector of switch recombination.

Publication types

  • Research Support, Non-U.S. Gov't
  • Research Support, U.S. Gov't, P.H.S.

MeSH terms

  • Animals
  • B-Lymphocytes / immunology*
  • Base Sequence
  • Cells, Cultured
  • DNA-Binding Proteins / metabolism*
  • Dextran Sulfate
  • Dextrans
  • Immunoglobulin mu-Chains / genetics*
  • Lipopolysaccharides
  • Lymphocyte Activation*
  • Methylation
  • Mice
  • Mice, Inbred BALB C
  • Mitogens
  • Molecular Sequence Data
  • Oligonucleotide Probes
  • Spleen / immunology

Substances

  • DNA-Binding Proteins
  • Dextrans
  • Immunoglobulin mu-Chains
  • Lipopolysaccharides
  • Mitogens
  • Oligonucleotide Probes
  • Dextran Sulfate